International Journal of Food Microbiology 165 (2013) 319–325 Contents lists available at SciVerse ScienceDirect International Journal of Food Microbiology j ourna l homepage: www.e lsev ie r .com/ locate / i j foodmicro Rapid detection and identification of Bacillus anthracis in food using pyrosequencing technology Kingsley K. Amoako ⁎, Timothy W. Janzen, Michael J. Shields, Kristen R. Hahn, Matthew C. Thomas, Noriko Goji Canadian Food Inspection Agency, National Centers for Animal Disease, Lethbridge Laboratory, P.O. Box 640, Township Road 9-1, Lethbridge, Alberta T1J 3Z4, Canada ⁎ Corresponding author. Tel.: +1 403 382 5597; fax: E-mail address: kingsley.amoako@inspection.gc.ca ( 0168-1605/$ – see front matter. Crown Copyright © 20 http://dx.doi.org/10.1016/j.ijfoodmicro.2013.05.028 a b s t r a c t a r t i c l e i n f o Article history: Received 18 October 2012 Received in revised form 23 April 2013 Accepted 29 May 2013 Available online 13 June 2013 Keywords: Anthrax Spores Immunomagnetic separation Sequence The development of advanced methodologies for the detection of Bacillus anthracis has been evolving rapidly since the release of the anthrax spores in the mail in 2001. Recent advances in detection and identification techniques could prove to be an essential component in the defense against biological attacks. Sequence based such as pyrosequencing, which has the capability to determine short DNA stretches in real-time using biotinylated PCR amplicons, has potential biodefense applications. Using markers from the virulence plasmids (pXO1 and pXO2) and chromosomal regions, we have demonstrated the power of this technology in the rapid, specific and sensitive detection of B. anthracis spores in food matrices including milk, juice, bottled water, and processed meat. The combined use of immunomagnetic separation and pyrosequencing showed positive detection when liquid foods (bottled water, milk, juice), and processed meat were experimentally inoculated with 6 CFU/mL and 6 CFU/g, respectively, without an enrichment step. Pyrosequencing is completed in about 60 min (following PCR amplification) and yields accurate and reliable results with an added layer of confidence. The entire assay (from sample preparation to sequencing information) can be completed in about 7.5 h. A typical run on food samples yielded 67–80 bp readswith 94–100% identity to the expected sequence. This sequence based approach is a novel application for the detection of anthrax spores in food with potential application in foodborne bioter- rorism response and biodefense involving the use of anthrax spores. Crown Copyright © 2013 Published by Elsevier B.V. All rights reserved. 1. Introduction Bacillus anthracis, the causative agent of anthrax and implicated in the 2001 anthrax attack in the US (Jernigan et al., 2002) has been used as a biological weapon for about 100 years (Tournier et al., 2009). Recent studies on the use of B. anthracis spores as a biological weapon following the 2001 anthrax attack have developed scenarios for intentional release including infecting water supplies or releasing aerosolized spores (Levin and Valadares, 2003; Meinhardt, 2005). Earlier reports by the WHO pre- dict that the release of 50 kg of spores upwind of 500,000 civilians could potentially result in 95,000 fatalities and over 10,000 fatalities may result if released in a single subway during rush hour (WHO, 1970). The above reports highlight the vulnerability of the civilian population to intention- al release of B. anthracis spores. Food is also reported to be a vulnerable target for intentional contamination and the use of Salmonella enterica serovar Typhimurium in the tainting of salad bars in the US make the use of biothreat agents such as B. anthracis spores a possibility (Torok et al., 1997). The prospect of this vulnerability is even more alarming given that no standards or established guidelines exist for testing foods for these biothreat agents (Kennedy, 2008). +1 403 381 1202. K.K. Amoako). 13 Published by Elsevier B.V. All rig B. anthracis belongs to the Bacillus cereus group (Helgason et al., 2000), however, members of this group share a great deal of morpho- logical, biochemical, and genetic similarities (Ash et al., 1991; Priest et al., 1988; Harrell et al., 1995), making differentiation an arduous task. Several reports have explored the use of chromosomal markers for the genotypic characterization of B. anthracis (Pearson et al., 2004; Van Ert et al., 2004; Hurtle et al., 2004; Hill et al., 2004; Ellerbrok et al., 2002; Qi et al., 2001). Molecular methods are also increasingly being used for rapid species discrimination. However, some methods used for Bacillus spp. such as restriction digests of a target gene (Joung and Cote, 2002) or randomly amplified polymorphic DNA analysis (Yamazaki et al., 1997) are limited in discriminating between a large group of species which exhibit high genetic similarities (Goto et al., 2000). Sequencing has shown to be particularly useful and with the increasing use of se- quencingmethods and decreased cost after the initial equipment invest- ment, more laboratories are using sequence data for species identification (Turenne et al., 2001). Even though anthrax can be distin- guished from closely related Bacilli with conventional biochemical tests, such as capsular staining, motility, hemolysis, and observing the presence of intracellular para-crystalline formation (Harrell et al., 1995; Helgason et al., 2000; Qi et al., 2001), these tests are time-consuming and may sometimes be inconclusive. Considering that these approaches for species identification can be tedious, expen- sive, and inaccurate, a rapid and accurate method yielding sequence hts reserved. http://crossmark.crossref.org/dialog/?doi=10.1016/j.ijfoodmicro.2013.05.028&domain=pdf http://dx.doi.org/10.1016/j.ijfoodmicro.2013.05.028 mailto:kingsley.amoako@inspection.gc.ca http://dx.doi.org/10.1016/j.ijfoodmicro.2013.05.028 http://www.sciencedirect.com/science/journal/01681605 320 K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 information is greatly needed. Pyrosequencing technology which has the capability to determine short DNA stretches in real-time using biotinylated PCR amplicons (Ronaghi et al., 1996) has recently been used for rapid sequence based detection in several biodefense applica- tions (Amoako et al., 2012b; Loveless et al., 2010; Wahab et al., 2005). The application of pyrosequencing for the detection of B. anthracis has been previously reported (Wahab et al., 2005; Ahmod et al., 2011), how- ever, the use of the technology for the specific and accurate detection of B. anthracis in complex matrices such as food has not been documented. Herewe report the first application of pyrosequencing for the specific de- tection and confirmationofB. anthracis from foodmatrices such as bottled water, juice, milk and processed meat. The pyrosequencing assays designed are based on chromosomal and virulence plasmid (pXO1 and pXO2) markers. In combination with an immunomagnetic assay previously developed (Shields et al., 2012), we demonstrate excellent detection capability without the need for an enrichment step. The work described here provides a novel tool for biodefense application in- volving potential foodborne bioterrorism response preparedness. 2. Materials and methods 2.1. Spore preparation B. anthracis Sterne spores were prepared from overnight cultures of single discrete colonies as previously described (Shields et al., 2012). Briefly, 100 μL of the overnight culture was used to inoculate culture flasks containing 50 mL of blood agar media. Flasks were incubated at 37 °C (without humidity) until sporulationwas complete (as determined by malachite green endospore staining). Spores were collected, trans- ferred into 50 mL falcon tubes, and washed with 50% ethanol (pelleted by centrifugation) to remove all remaining vegetative cells. The spores were then resuspended in phosphate buffered saline (PBS) with 1% Bovine Serum Albumin (BSA), aliquoted and stored at−20 °C until use. 2.2. Extraction and quantification of genomic DNA Genomic DNAwas extracted from65 bacterial isolates (Table 1), 20 of which are B. anthracis. All bacterial strainswere first cultured fromglycer- ol stocks on Tryptic Soy Agar Plates supplemented with 5% sheep blood (TSBAP) and subsequently a single, discrete colonywas subcultured over- night at 37 °C in Tryptic Soy Broth (TSB) prior to DNA extraction. B. anthracis DNA was extracted, according to the manufacturer's instruc- tions, using theMasterPure GramPositive DNA Purification Kit (Epicen- ter Biotechnologies, Madison, WI, USA), while the DNA from the remaining strains was extracted using the DNeasy Tissue kit (Qiagen Inc., Mississauga, ON, Canada) according to the manufacturer's instruc- tions. DNA concentrations were then determined using a NanoDrop ND-8000 spectrophotometer (NanoDrop Technologies Inc., Wilming- ton, DE) and diluted to 5.71 ng/μL (106 B. anthracis genomic equivalents permicroliter) for downstreamuse. The sources of some of the bacterial strains used are described in a previous report (Amoako et al., 2010). 2.3. Design of oligonucleotide primers for pyromark assays Genomic signatures on the two virulence plasmids (pXO1 and pXO2) and a region of the B. anthracis chromosome were selected as targets for the specific detection of the organism. Consensus sequences from five genomic sequences (Accession numbers: B. anthracis str. CDC684 (CP001215), B. anthracis str. A0248 (CP001598), B. anthracis str. Ames (AE016879), B. anthracis str. Sterne (AE017225), B. anthracis str. ‘Ames Ancestor’ (AE017334)), five pXO1 sequences (B. anthracis str. A0248 plasmid pXO1 (CP001599), B. anthracis str. ‘Ames Ancestor’ plasmid pXO1 (AE017336), B. anthracis virulence plasmid pXO1 (AF065404), B. anthracis str. A2012 plasmid pXO1 (AE011190), B. anthracis str. CDC684 (CP001216)) and five pXO2 sequences (B. anthracis str. CDC684 plasmid pXO2 (CP001214), B. anthracis str. ‘Ames Ancestor’ plasmid pXO2 (AE017335), B. anthracis str. A0248 (CP001597), B. anthracis plasmid pXO2 (AF188935), B. anthracis str. A2012 plasmid pXO2 (AE011191)) were determined using the Geneious Software Suite (version 5.3.5; Biomatters Inc. [http://www.geneious.com]). Con- sensus sequences for chromosome and plasmid targets were imported into the Pyromark Assay Design software (version 2.0.1.15; Qiagen Inc. [http://www.pyrosequencing.com/dynpage.aspx?id=7257]), which was used to design the sequencing primers based on the se- quence analysis method (SQA) for all targets (Table 2). Following de- sign, all primers were examined for specificity in silico using the NCBI Primer-BLAST tool (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). 2.4. PCR amplification and specificity A panel of DNA extracted from 65 bacterial strains (20 B. anthracis isolates and 45 strains which are either closely or distantly related to B. anthracis) was used to screen the pyrosequencing primers for speci- ficity (Table 1). Preliminary examination of the PCR primers was performed using 1× PCR Supermix (Invitrogen Life Technologies, Inc., Carlsbad, CA), 0.5 μM forward and reverse primers (one of which is bio- tin labeled, see Table 2), and 5.71 ng DNA template in a final volume of 25 μL. Thermocycling conditions were 95 °C for 5 min, followed by 50 cycles of: 58 °C for 20 s, 72 °C for 30 s, 95 °C for 10 s, and a final ex- tension step at 72 °C for 5 min. Pyromark PCR reactions were performed similarly as described above with 1× Pyromark PCR mastermix (Qiagen Inc.) substituted for the Invitrogen PCR Supermix. PCR amplicons were visualized using a QIAxcel system (Qiagen Inc.) and analyzed using the AM320 method, along with the QIAxcel DNA screening kit. PCR in which amplification was successful were then selected for analysis by pyrosequencing. 2.5. Pyrosequencing and data analysis The 5′ biotin linked PCR products were placed in 24-well plates and bound to streptavidin coated sepharose beads according to the manufacturer's instructions (GE Healthcare, Piscataway, NJ). The PCR products were denatured and all non-biotin labeled DNA fragments werewashed awayusing the PyromarkQ24vacuumworkstation (Qiagen Inc.). The sepharose beads were then resuspended in an annealing buffer containing 0.3 μM sequencing primer. The pyrosequencing reaction was performed in triplicate using the Pyro Gold Q24 reagents with a predetermined dispensation specific for the target amplicon, using the Pyromark Q24 system. The raw data files were imported into the Pyromark Q24 soft- ware (version 2.0; Qiagen Inc. [http://www.qiagen.com/products/ pyromarkq24.aspx]) for analysis. The sequences obtained were then compared to the GenBank database (http://www.ncbi.nlm.nih.gov/ genbank/) using the sequence search built into the Geneious software suite (MegaBlast algorithm). 2.6. Preparation of spiked food samples Bottledwater, apple juice, wholemilk (3.25%milk fat) and processed meat (black forest ham) were purchased from a local grocery store and used for the food spiking experiments as previously described (Shields et al., 2012). Briefly, B. anthracis spores were added to 25 mL of liquid foods to achieve a cell inoculation of 6 CFU/mL. The bottled water and milk samples were diluted with 25 mL of BPW containing 1% Tween-20 (BPWT, pH 7.2), and the apple juice sample was diluted with 25 mL of BPW containing 0.2 M Na2HPO4 and 1% Tween-20 (pH 8.0). For bacterial capture in solid food, 50 g of processed meat was sliced into 1 cm2 pieces and inoculatedwith 6 CFU/g of B. anthracis spores. Fifty milliliters of BPWT (pH 7.2) was added (1:1 dilution w/v) and themixture was stomached. The liquid was further passed through a sponge filter with a 60 μm above the sponge and a 30 μm filter below using a vacuum pump and the filtrate was collected for analysis. http://www.geneious.com http://www.pyrosequencing.com/dynpage.aspx?id=7257 http://www.ncbi.nlm.nih.gov/blast/Blast.cgi http://wwww.qiagen.com/products/pyromarkq24.aspx http://wwww.qiagen.com/products/pyromarkq24.aspx http://www.ncbi.nlm.nih.gov/genbank/ http://www.ncbi.nlm.nih.gov/genbank/ Table 1 Panel of DNA samples screened to determine specificity of the primer sets. Bacterial strain Primer set Cya gerXB capBCAD acpB prophage lambda1 prophage lambda3 Bacillus anthracis isolate 15 + + − − + + Bacillus anthracis isolate 35 + + + + + + Bacillus anthracis isolate 44 + + + + + + Bacillus anthracis isolate 53 + + + + + + Bacillus anthracis isolate 56 + + + + + + Bacillus anthracis isolate 59 + + + + + + Bacillus anthracis isolate 79 + + + + + + Bacillus anthracis isolate 127 + + + + + + Bacillus anthracis isolate 128 + + + + + + Bacillus anthracis isolate 131 + + + + + + Bacillus anthracis isolate 155 − − − − + + Bacillus anthracis isolate 158 − − + + + + Bacillus anthracis isolate 179 + + + + + + Bacillus anthracis isolate 240 + + + + + + Bacillus anthracis isolate 252 + + + + + + Bacillus anthracis isolate 552 + + + + + + Bacillus anthracis isolate 9616 + + + + + + Bacillus anthracis 03-0191 + + + + + + Bacillus anthracis Sterne strain + + − − + + Bacillus anthracis Ames strain + + + + + + Bacillus cereus ATCC 31101 − − − − − − Bacillus cereus ATCC 14579 − − − − − − Bacillus cereus ATCC 15816 − − − − − − Bacillus cereus ATCC 10876 − − − − − − Bacillus subtilis NWBL 0060 − − − − − − Bacillus coagulans ATCC 7050 − − − − − − Bacillus thuringiensis ATCC 10792 − − − − − − Bacillus brevis ATCC 8246 − − − − − − Bacillus licheniformis ATCC 12759 − − − − − − Bacillus circulans ATCC 61 − − − − − − Proteus vulgaris ATCC 13315 − − − − − − Klebsiella pneumoniae ATCC 13993 − − − − − − Shigella dysenteriae ATCC 11835 − − − − − − Escherichia coli O157:H7 EDL 933 − − − − − − Escherichia coli ATCC 25922 − − − − − − Pasteurella haemolytica Z13 − − − − − − Clostridium perfringens ATCC131124 − − − − − − Acinetobacter baumanii strain 14B − − − − − − Vibrio vulnificus Z89 − − − − − − Citrobactor brackii ATCC 12012 − − − − − − Salmonella typhimurium 71−471 − − − − − − Aeromonas hydrophila Z22 − − − − − − Pseudomonas aeruginosa ATCC 27853 − − − − − − Streptococcus pneumoniae ATCC 49619 − − − − − − Streptococcus pyogenes ATCC 19615 − − − − − − Enterococcus faecalis ATCC 29212 − − − − − − Micrococcus lysodeikticus Z9 − − − − − − Staphylococcus aureus ATCC 25923 − − − − − − Campylobacter coli NML 06−0224 − − − − − − Campylobacter jejuni ATCC 11168 − − − − − − Legionella pneumophila ATCC 33153 − − − − − − Listeria monocytogenes NTCC 7933 − − − − − − Listeria grayi ATCC 19120 − − − − − − Listeria innocua ATCC 33090 − − − − − − Listeria ivanovii ATCC 19119 − − − − − − Listeria murrayi ATCC 25401 − − − − − − Listeria seelingeri ATCC 35967 − − − − − − Listeria welshimeri ATCC 35897 − − − − − − Yersinia enterolytica ATCC 23715 − − − − − − Yersinia frederiksenii ATCC 33641 − − − − − − Yersinia intermedia ATCC 29909 − − − − − − Yersinia kristensenii ATCC33638 − − − − − − Yersinia enterolytica (food isolate) − − − − − − Yersinia pestis CO92 − − − − − − Yersinia pseudotuberculosis ATCC 39833 − − − − − − 321K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 2.7. Immunomagnetic capture of B. anthracis Sterne spores from spiked food samples Following the preparation of spiked food samples, 50 mL of the prepared food sample was mixed with 1 mg (50 μL) of Pathatrix (Life Technologies Inc., Carlsbad CA, USA) beads functionalized with rabbit anti-B. anthracis polyclonal antibody (Tetracore, Rockville MD, USA). The specificity of the antibody has been demonstrated in our previous paper (Shields et al., 2012). The beads were mixed, cap- tured and washed according to the iCropTheBug method as previously described (Shields et al., 2012). Extracted beads were resuspended in 150 μL of TE. DNA was extracted using the Epicenter MasterPure DNA Table 2 Pyrosequencing primers for the rapid identification of B. anthracis. Target Gene Primer sequence (5′–3′) Amplicon size (bp) Sequencing primer (5′–3′) Max read length (bp) pXO1 Cya F: GTGGTGTGGCTACAAAGGGATTGAATGT 123 CAAAGGGATTGAATGTT 94 Biotin-R: TCTCGACAGCTAATTGTTGACCATGCTTCT gerXB F: TGGAGTTTGGTCCATTTGTGGCCG 129 GTGGCCGCAAATCAG 97 Biotin-R: AAACCCCTACAAGCCACTGGTACAC pXO2 acpB Biotin-F: CACAGGAGAAAGTGAAAGTTGGGCAGA 166 AGTCAGCATTAACATCGT 107 R: AGGGGTTGAACCTAAGTCAAGAGGTATTGT capBCAD Biotin-F: GTCTTGCAAGCTACCCTTACCATGCG 139 Same as reverse primer 113 R: ACGAACGTTTATGGCCCCCACTGTAT Chromosome prophage lambda1 F: GGGGGATTAATTGCAAAAGCGTGTT 94 TTGCAAAAGCGTGTT 69 Biotin-R: CCCATGGCGTTCCCATAGTTATGA prophage lambda3 F: GGTGATGCGTCAAAAGCCGATGGA 122 AAAAGCCGATGGAAC 94 Biotin-R: TTACGTGGGCCAAATTGTCCCGTTT 322 K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 Extraction kit and subjected to the pyrosequencing method described above. 3. Results 3.1. Specificity of selected B. anthracis pyrosequencing targets All primer sets generated by the Geneious software were first test- ed for specificity to B. anthracis through in silico comparison to the GenBank nucleotide database. The six resulting primer sets presented in Table 1 showed no cross-reactivity with other bacterial strains in silico, and were selected for further analysis through in vitro screening against a DNA panel consisting of 65 bacterial strains (Table 1). As shown, all six targets (two each for pXO1, pXO2 and the chromosome) were specific for B. anthracis, with no amplification from the other bac- terial strains tested. Additionally, the B. anthracis strains which lacked pXO1 (isolate 155 and isolate 158), along with those which lack pXO2 (isolate 15, isolate 155 and B. anthracis Sterne strain), were correctly identified as such. 3.2. Evaluation of B. anthracis pyrosequencing targets The chromosomal and plasmid targets that were identified as spe- cific for B. anthraciswere compared based on the read length obtained from pyrosequencing. The average read length for each target across all 20 B. anthracis strains was 48 bp for acpB, 42 bp for capBCAD, 68 bp for gerXB, 64 bp for cya, 54 bp for prophage lambda3 and 36 bp for prophage lambda1. These read lengths were within the range recommended by the PyroMark manufacturer (http://www.qiagen.com/faq/faqview. aspx?faqid=2216&S). From this data, an optimal set of targets (gerXB for pXO1, acpB for pXO2 and prophage lambda3 for the chromosome) which had comparatively higher read lengths, was selected for the spe- cific detection of B. anthracis using pyrosequencing technology. Fig. 1 shows the alignment of pyrosequencing reads obtained from 20 B. anthracis isolates examined with each of the optimal targets (gerXB, acpB and prophage lambda3). The data collected from three additional targets (cya, capBCAD and prophage lambda1) also showed alignment with the consensus sequence (data not shown). As can be seen, the sequences align very well to the consensus sequence obtained from the GenBank database. All B. anthracis strains tested in this study align to the consensus and show greater than 97% identity, indicating positive identification of B. anthracis. 3.3. Detection of B. anthracis Sterne spores in spiked food matrices Using the pXO1 and chromosome targets, we successfully detected and identified B. anthracis Sterne spores in liquid food matrices (water, apple juice, milk), and processed meat when experimentally inoculated at 6 CFU/mL (150 CFU per 25 mL), and 6 CFU/g (300 CFU per 50 g), re- spectively (Table 3). DNA extracted from the food spiking assays produced long, quality sequencing reads (67–80 bp) which yielded BLAST results of over 94% sequence identity. 4. Discussion Recent outbreaks of E. coli, S. enterica serovar Typhimurium, and L. monocytogenes in North American and European food supplies demonstrate the vulnerability of food (Tauxe et al., 2010; King et al., 2012) and highlight food as a soft target for intentional contamination. These outbreaks indicate that rapid detection methods with greater ac- curacy are required to address any potential food contamination involv- ing biothreat agents. However, to date a critical gap still remains, as no standards, established guidelines or routines exist to test for these threats in food (Kennedy, 2008). In recent years there has been some development of methods for the detection of biothreat agents in food (Wielinga et al., 2011a; Amoako et al., 2010; Shields et al., 2012; Reekmans et al., 2009;Woubit et al., 2012; Amoako et al., 2012a), how- ever, there is still much to be done. Since the release of anthrax spores in the mail in 2001, the develop- ment of advanced methodologies for the detection of biothreat agents (including B. anthracis) has been evolving rapidly. Some of the recent advances in detection and identification techniques (Amoako et al., 2012b; Walker et al., 2010; Qu et al., 2010; Laue and Bannert, 2010; Janse et al., 2010; Lian et al., 2010; Sapsford et al., 2011; McGrath et al., 2011;Wielinga et al., 2011b) could prove to be an essential compo- nent in the defense against biological attacks. In particular, methods that offer greater speed and accuracy such as those based on pyrosequencing (Wahab et al., 2005; Amoako et al., 2012b; Ahmod et al., 2011) will contribute significantly to an effective response against biological attacks. A crucial factor in accurate biothreat agent identifica- tion is the capability to discriminate between the target agent and its near neighbors. Sequencing based methods such as pyrosequencing offer a better resolution in discriminating between closely related mi- crobial species. There is the added layer of confidence in the use of se- quence based methods since the sequence information generated can be used for both confirmation of pathogen presence and trace-back to source. To our knowledge there is no report on the use of sequence based genomics approaches for the direct detection of B. anthracis in food. We have demonstrated in this study the first application of pyrosequencing for the rapid detection, identification and confirmation of B. anthracis in food matrices such as milk, bottled water, juice and processed meat. The combined use of immunomagnetic separation (Shields et al., 2012) and pyrosequencing showed positive detection when liquid foods (bottled water, milk, juice), and processed meat were experimentally inoculated with 6 CFU/mL and 6 CFU/g, respec- tively, without an enrichment step. Sequencing runs are completed in about 60 min after PCR amplification and this rapid turnaround time (about 7.5 h from sample to sequence results), together with the accu- rate sequence information generated (>94% sequence identity was suf- ficient to positively identify the presence of B. anthracis), will enable http://www.qiagen.com/faq/faqview.aspx?faqid=2216&S http://www.qiagen.com/faq/faqview.aspx?faqid=2216&S Table 3 Pyrosequencing read lengths and BLAST identities for B. anthracis Sterne spores in the food matrices. Food matrix Target Read length (bp) % Identity (BLAST) Water cya 77 100% gerXB 80 >94% prophage lambda1 67 >95% prophage lambda3 72 >97% Apple juice cya 77 100% gerXB 80 >96% prophage lambda1 67 >95% prophage lambda3 72 >97% Milk cya 77 100% gerXB 80 >96% prophage lambda1 67 >97% prophage lambda3 72 >97% Sliced ham cya 77 100% gerXB 80 >96% prophage lambda1 67 >97% prophage lambda3 72 >98% Fig. 1. Alignments of the sequence data collected during pyrosequencing assays for the downselected targets (gerXB for pXO1, acpB for pXO2, and prophage lambda3 for the chromosome). Assays were run in triplicate and consensus read sequences are shown for each isolate. 323K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 rapid informed decisions to bemade during a foodborne contamination and thereby minimize the effect on public health. The sequence identi- ties were not verified by regular sequencing to determine if there were errors since our goal was to determine the presence of B. anthracis and not sequence variation such as SNPs or mutations. In addition to the high sequence identity, the genetic targets used (based on the two viru- lence plasmids pXO1 and pXO2) have the ability to provide information on the virulence potential of the implicated anthrax strain as well. The generation of two targets for each virulence plasmid provides an extra measure of confidence and will compensate for any potential mutation that may occur in any of the target primer regions. Furthermore, the in- clusion of a chromosomal target also enables the detection and identifi- cation of strains that have lost either of the two plasmids. 5. Conclusion In conclusion, this report has for the first time demonstrated the power of pyrosequencing combined with Immunomagnetic separation 324 K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 in the detection of B. anthracis from both simple and complex food ma- trices includingbottledwater, apple juice,milk and processedmeat. The levels of detection observed after experimental inoculation without an enrichment step are unprecedented and together with the one hour time for completing pyrosequencing runs following PCR amplification offer an effective detection system for anthrax in food. The current work is novel for detection of anthrax spores in food and provides a systemwith potential application in a foodborne bioterrorism response involving the use of anthrax spores. In food biodefense application, culture confirmation takes too long, hence the ability to rapidly se- quence a PCR fragment using pyrosequencing provides an added layer of confidence and helps to make rapid informed decisions on food contamination. Acknowledgments We thank Dr. Elizabeth Golsteyn Thomas (Canadian Food Inspection Agency, Lethbridge), Dr. Lisa Waddington (Canadian Food Inspection Agency, Dartmouth),Ms. Victoria Arling (Canadian Food InspectionAgen- cy, Calgary), Mr. Doug Bader (Defence Research Development Canada, Suffield), and Dr. Matthew Gilmour (Public Health Agency Canada, Winnipeg) for providing the additional bacterial strains used in this study.We acknowledge the useful suggestions of Dr. SorenAlexandersen regarding themanuscript.We also thank Fanliang Kong andCai Guan for providing technical assistance. This work was funded by the Defence Research Development Canada Centre for Security Science, Chemical, Biological, Radiological, Nuclear and Explosive Research Technology Ini- tiative (CRTI) funding from CRTI 08-0203RD. References Ahmod, N.Z., Gupta, R.S., Shah, H.N., 2011. Identification of a Bacillus anthracis specific indel in the yeaC gene and development of a rapid pyrosequencing assay for distinguishing B. anthracis from the B. cereus group. Journal of Microbiological Methods 87, 278–285. Amoako, K.K., Goji, N., Macmillan, T., Said, K.B., Druhan, S., Tanaka, E., Golsteyn, Thomas E., 2010. Development of multitarget real-time PCR for the rapid, specific, and sen- sitive detection of Yersinia pestis in milk and ground beef. Journal of Food Protec- tion 73, 18–25. Amoako, K.K., Shields, M.J., Goji, N., Paquet, C., Thomas, M.C., Janzen, T.W., Kingombe, C., Kell, A., Hahn, K.R., 2012a. Rapid detection and identification of Yersinia pestis from food using immunomagnetic separation and pyrosequencing. Journal of Patho- gens 2012, 1–6. Amoako, K.K., Thomas, M.C., Kong, F., Janzen, T.W., Hahn, K.R., Shields, M.J., Goji, N., 2012b. Rapid detection and antimicrobial resistance gene profiling of Yersinia pestis using pyrosequencing technology. Journal of Microbiological Methods 90, 228–234. Ash, C., Farrow, J.A., Dorsch, M., Stackebrandt, E., Collins, M.D., 1991. Comparative anal- ysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. International Journal of Systematic Bacteri- ology 41, 343–346. Ellerbrok, H., Nattermann, H., Ozel, M., Beutin, L., Appel, B., Pauli, G., 2002. Rapid and sensitive identification of pathogenic and apathogenic Bacillus anthracis by real- time PCR. FEMS Microbiology Letters 214, 51–59. Goto, K., Omura, T., Hara, Y., Sadaie, Y., 2000. Application of the partial 16S rDNA se- quence as an index for rapid identification of species in the genus Bacillus. Journal of General and Applied Microbiology 46, 1–8. Harrell, L.J., Andersen, G.L., Wilson, K.H., 1995. Genetic variability of Bacillus anthracis and related species. Journal of Clinical Microbiology 33, 1847–1850. Helgason, E., Okstad, O.A., Caugant, D.A., Johansen, H.A., Fouet, A., Mock, M., Hegna, I., Kolsto, 2000. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—one spe- cies on the basis of genetic evidence. Applied and Environmental Microbiology 66, 2627–2630. Hill, K.K., Ticknor, L.O., Okinaka, R.T., Asay, M., Blair, H., Bliss, K.A., Laker, M., Pardington, P.E., Richardson, A.P., Tonks, M., Beecher, D.J., Kemp, J.D., Kolsto, A.B., Wong, A.C., Keim, P., Jackson, P.J., 2004. Fluorescent amplified fragment length polymorphism analysis of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis isolates. Applied and Environmental Microbiology 70, 1068–1080. Hurtle, W., Bode, E., Kulesh, D.A., Kaplan, R.S., Garrison, J., Bridge, D., House, M., Frye, M.S., Loveless, B., Norwood, D., 2004. Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. Journal of Clinical Microbiology 42, 179–185. Janse, I., Hamidjaja, R.A., Bok, J.M., van Rotterdam, B.J., 2010. Reliable detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis by using multiplex qPCR including internal controls for nucleic acid extraction and amplification. BMC Microbiology 10, 314. Jernigan, D.B., Raghunathan, P.L., Bell, B.P., Brechner, R., Bresnitz, E.A., Butler, J.C., Cetron, M., Cohen,M., Doyle, T., Fischer, M., Greene, C., Griffith, K.S., Guarner, J., Hadler, J.L., Hayslett, J.A., Meyer, R., Petersen, L.R., Phillips, M., Pinner, R., Popovic, T., Quinn, C.P., Reefhuis, J., Reissman, D., Rosenstein, N., Schuchat, A., Shieh,W.J., Siegal, L., Swerdlow, D.L., Tenover, F.C., Traeger, M., Ward, J.W., Weisfuse, I., Wiersma, S., Yeskey, K., Zaki, S., Ashford, D.A., Perkins, B.A., Ostroff, S., Hughes, J., Fleming, D., Koplan, J.P., Gerberding, J.L., 2002. Inves- tigation of bioterrorism-related anthrax, United States, 2001: epidemiologic findings. Emerging Infectious Diseases 8, 1019–1028. Joung, K.B., Cote, J.C., 2002. Evaluation of ribosomal RNA gene restriction patterns for the classification of Bacillus species and related genera. Journal of AppliedMicrobiology 92, 97–108. Kennedy, S., 2008. Epidemiology. Why can't we test our way to absolute food safety? Science 322, 1641–1643. King, L.A., Nogareda, F., Weill, F.X., Mariani-Kurkdjian, P., Loukiadis, E., Gault, G., Jourdan-DaSilva, N., Bingen, E., Mace, M., Thevenot, D., Ong, N., Castor, C., Noel, H., Van, C.D., Charron, M., Vaillant, V., Aldabe, B., Goulet, V., Delmas, G., Couturier, E., Le, S.Y., Combe, C., Delmas, Y., Terrier, F., Vendrely, B., Rolland, P., de, V.H., 2012. Outbreak of Shiga toxin-producing Escherichia coli O104:H4 associated with organic fenugreek sprouts, France, June 2011. Clinical Infectious Diseases 54, 1588–1594. Laue, M., Bannert, N., 2010. Detection limit of negative staining electron microscopy for the diagnosis of bioterrorism-relatedmicro-organisms. Journal of AppliedMicrobiology 109, 1159–1168. Levin, D.B., Valadares, d.A., 2003. Potential for aerosol dissemination of biological weapons: lessons from biological control of insects. Biosecurity and Bioterrorism 1, 37–42. Lian, W., Wu, D., Lim, D.V., Jin, S., 2010. Sensitive detection of multiplex toxins using antibody microarray. Analytical Biochemistry 401, 271–279. Loveless, B.M., Yermakova, A., Christensen, D.R., Kondig, J.P., Heine III, H.S., Wasieloski, L.P., Kulesh, D.A., 2010. Identification of ciprofloxacin resistance by simpleprobe, high resolution melt and pyrosequencing nucleic acid analysis in biothreat agents: Bacillus anthracis, Yersinia pestis and Francisella tularensis. Molecular and Cellular Probes 24, 154–160. McGrath, S.C., Schieltz, D.M., McWilliams, L.G., Pirkle, J.L., Barr, J.R., 2011. Detection and quantification of ricin in beverages using isotope dilution tandem mass spectrom- etry. Analytical Chemistry 83, 2897–2905. Meinhardt, P.L., 2005. Water and bioterrorism: preparing for the potential threat to U.S. water supplies and public health. Annual Review of Public Health 26, 213–237. Pearson, T., Busch, J.D., Ravel, J., Read, T.D., Rhoton, S.D., U'Ren, J.M., Simonson, T.S., Kachur, S.M., Leadem, R.R., Cardon, M.L., Van Ert, M.N., Huynh, L.Y., Fraser, C.M., Keim, P., 2004. Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymor- phisms from whole-genome sequencing. Proceedings of the National Academy of Sci- ences of the United States of America 101, 13536–13541. Priest, F.G., Goodfellow, M., Todd, C., 1988. A numerical classification of the genus Bacillus. Journal of General Microbiology 134, 1847–1882. Qi, Y., Patra, G., Liang, X., Williams, L.E., Rose, S., Redkar, R.J., DelVecchio, V.G., 2001. Utili- zation of the rpoB gene as a specific chromosomalmarker for real-time PCR detection of Bacillus anthracis. Applied and Environmental Microbiology 67, 3720–3727. Qu, S., Shi, Q., Zhou, L., Guo, Z., Zhou, D., Zhai, J., Yang, R., 2010. Ambient stable quanti- tative PCR reagents for the detection of Yersinia pestis. PLoS Neglected Tropical Dis- eases 4, e629. Reekmans, R., Stevens, P., Vervust, T., De, V.P., 2009. An alternative real-time PCR method to detect the Bacillus cereus group in naturally contaminated food gelatine: a compar- ison study. Letters in Applied Microbiology 48, 97–104. Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlén, M., Nyrén, P., 1996. Real-time DNA sequencing using detection of pyrophosphate release. Analytical Biochemistry 242, 84–89. Sapsford, K.E., Granek, J., Deschamps, J.R., Boeneman, K., Blanco-Canosa, J.B., Dawson, P.E., Susumu, K., Stewart, M.H., Medintz, I.L., 2011. Monitoring botulinum neurotoxin a activity with peptide-functionalized quantum dot resonance energy transfer sen- sors. ACS Nano 5, 2687–2699. Shields, M.J., Hahn, K.R., Janzen, T.W., Goji, N., Thomas, M.C., Bin Kingombe, C.I., Paquet, C., Kell, A.J., Amoako, K.K., 2012. Immunomagnetic capture of Bacillus anthracis spores from food. Journal of Food Protection 75, 1243–1248. Tauxe, R.V., Doyle, M.P., Kuchenmuller, T., Schlundt, J., Stein, C.E., 2010. Evolving public health approaches to the global challenge of foodborne infections. International Journal of Food Microbiology 139 (Suppl. 1), S16–S28. Torok, T.J., Tauxe, R.V., Wise, R.P., Livengood, J.R., Sokolow, R., Mauvais, S., Birkness, K.A., Skeels, M.R., Horan, J.M., Foster, L.R., 1997. A large community outbreak of sal- monellosis caused by intentional contamination of restaurant salad bars. Journal of the American Medical Association 278, 389–395. Tournier, J.N., Ulrich, R.G., Quesnel-Hellmann, A., Mohamadzadeh, M., Stiles, B.G., 2009. Anthrax, toxins and vaccines: a 125-year journey targeting Bacillus anthracis. Expert Review of Anti-Infective Therapy 7, 219–236. Turenne, C.Y., Tschetter, L., Wolfe, J., Kabani, A., 2001. Necessity of quality-controlled 16S rRNA gene sequence databases: identifying nontuberculous Mycobacterium species. Journal of Clinical Microbiology 39, 3637–3648. Van Ert, M.N., Hofstadler, S.A., Jiang, Y., Busch, J.D., Wagner, D.M., Drader, J.J., Ecker, D.J., Hannis, J.C., Huynh, L.Y., Schupp, J.M., Simonson, T.S., Keim, P., 2004. Mass spectrometry provides accurate characterization of two genetic marker types in Bacillus anthracis. Biotechniques 37, 642–644 (646, 648). Wahab, T., Hjalmarsson, S., Wollin, R., Engstrand, L., 2005. Pyrosequencing Bacillus anthracis. Emerging Infectious Diseases 11, 1527–1531. Walker, R.E., Petersen, J.M., Stephens, K.W., Dauphin, L.A., 2010. Optimal swab processing recovery method for detection of bioterrorism-related Francisella tularensis by real- time PCR. Journal of Microbiological Methods 83, 42–47. WHO, 1970. Health Aspects of Chemical and Biological Weapons. WHO. http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0005 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0005 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0005 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0005 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0010 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0010 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0010 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0015 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0015 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0015 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0020 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0020 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0020 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0025 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0025 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0025 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0025 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0030 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0030 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0030 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0035 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0035 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0035 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0040 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0040 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0045 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0045 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0045 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0050 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0050 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0050 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0055 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0055 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0055 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0060 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0060 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0060 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0060 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0065 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0065 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0065 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0070 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0070 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0070 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0075 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0075 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0080 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0080 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0080 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0085 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0085 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0085 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0090 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0090 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0090 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0095 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0095 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0100 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0100 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0100 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0100 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0105 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0105 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0105 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0110 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0110 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0115 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0115 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0115 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0120 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0120 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0125 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0125 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0125 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0130 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0130 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0130 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0135 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0135 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0135 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0140 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0140 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0140 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0145 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0145 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0145 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0150 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0150 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0155 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0155 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0155 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0160 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0160 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0160 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0165 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0165 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0170 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0170 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0170 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0175 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0175 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0175 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0180 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0180 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0185 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0185 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0185 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0190 325K.K. Amoako et al. / International Journal of Food Microbiology 165 (2013) 319–325 Wielinga, P.R., de, H.L., de, G.A., Hamidjaja, R.A., Bruggeman, G., Jordan, K., van Rotterdam, B.J., 2011a. Evaluation of DNA extraction methods for Bacillus anthracis spores spiked to food and feedmatrices at biosafety level 3 conditions. International Journal of Food Microbiology 150, 122–127. Wielinga, P.R., Hamidjaja, R.A., Agren, J., Knutsson, R., Segerman, B., Fricker, M., Ehling- Schulz, M., de, G.A., Burton, J., Brooks, T., Janse, I., van, R.B., 2011b. A multiplex real- time PCR for identifying and differentiating B. anthracis virulent types. Internation- al Journal of Food Microbiology 145 (Suppl. 1), S137–S144. Woubit, A., Yehualaeshet, T., Habtemariam, T., Samuel, T., 2012. Novel genomic tools for specific and real-time detection of biothreat and frequently encountered foodborne pathogens. Journal of Food Protection 75, 660–670. Yamazaki, K., Okubo, T., Inoue, N., Shin, H., 1997. Randomly amplified polymorphic DNA (RAPD) for rapid identification of spoilage bacterium Alicyclobacillus acidoterrestris. Bioscience, Biotechnology, and Biochemistry 61, 1016–1019. http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0195 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0195 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0195 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0200 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0200 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0200 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0205 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0205 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0205 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0210 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0210 http://refhub.elsevier.com/S0168-1605(13)00276-6/rf0210 Rapid detection and identification of Bacillus anthracis in food using pyrosequencing technology 1. Introduction 2. Materials and methods 2.1. Spore preparation 2.2. Extraction and quantification of genomic DNA 2.3. Design of oligonucleotide primers for pyromark assays 2.4. PCR amplification and specificity 2.5. Pyrosequencing and data analysis 2.6. Preparation of spiked food samples 2.7. Immunomagnetic capture of B. anthracis Sterne spores from spiked food samples 3. Results 3.1. Specificity of selected B. anthracis pyrosequencing targets 3.2. Evaluation of B. anthracis pyrosequencing targets 3.3. Detection of B. anthracis Sterne spores in spiked food matrices 4. Discussion 5. Conclusion Acknowledgments References